Paired-end fastq quality control with Skewer
Quality trimming and adapter clipping paired end reads is a tricky business. For paired-end alignments to work, the order of the sequences in both files (forward and reverse) needs to be retained. While there are plenty of read trimmers available open-source (think FASTX-toolkit, SeqTK, CutAdapt, etc), I haven't found many that: Retain pairing info Run parallel and are fast Are easy to set up and run Have good docs Then I fell in love with Skewer . It smashed through 14.5 million gzipped read pairs, doing adapter clipping and quality trimming in two minutes on my 8-core workstation. It auto-detects quality encoding so you can safely analyse any Illumina data. Awesome! $ skewer -t 8 -q 20 SRR634969.sra_1.fastq.gz SRR634969.sra_2.fastq.gz Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel er...