Paired-end fastq quality control with Skewer

Quality trimming and adapter clipping paired end reads is a tricky business. For paired-end alignments to work, the order of the sequences in both files (forward and reverse) needs to be retained. While there are plenty of read trimmers available open-source (think FASTX-toolkit, SeqTK, CutAdapt, etc), I haven't found many that:

  • Retain pairing info
  • Run parallel and are fast
  • Are easy to set up and run
  • Have good docs

Then I fell in love with Skewer. It smashed through 14.5 million gzipped read pairs, doing adapter clipping and quality trimming in two minutes on my 8-core workstation. It auto-detects quality encoding so you can safely analyse any Illumina data. Awesome!

$ skewer -t 8 -q 20 SRR634969.sra_1.fastq.gz SRR634969.sra_2.fastq.gz
Parameters used:
-- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r): 0.100
-- maximum indel error ratio allowed (-d): 0.030
-- end quality threshold (-q): 20
-- minimum read length allowed after trimming (-l): 18
-- file format (-f): Sanger/Illumina 1.8+ FASTQ (auto detected)
-- number of concurrent threads (-t): 8
Thu Mar 19 22:19:26 2015 >> started
|=================================================>| (100.00%)
Thu Mar 19 22:21:31 2015 >> done (124.590s)
14555046 read pairs processed; of these:
   35892 ( 0.25%) short read pairs filtered out after trimming by size control
   21534 ( 0.15%) empty read pairs filtered out after trimming by size control
14497620 (99.61%) read pairs available; of these:
 5122437 (35.33%) trimmed read pairs available after processing
 9375183 (64.67%) untrimmed read pairs available after processing
log has been saved to "SRR634969.sra_1.fastq-trimmed.log".
Location: Saint Kilda VIC 3182, Australia

Popular posts from this blog

Data analysis step 8: Pathway analysis with GSEA

Image
In our RNA-seq series so far we've performed differential analysis and generated some pretty graphs, showing thousands of differentially expressed genes after azacitidine treatment. In order to understand the biology underlying the differential gene expression profile, we need to perform pathway analysis. We use Gene Set Enrichment Analysis ( GSEA ) because it can detect pathway changes more sensitively and robustly than some methods. A 2013 paper compared a bunch of gene set analyses software with microarrays and is worth a look. Generate a rank file The rank file is a list of detected genes and a rank metric score. At the top of the list are genes with the "strongest" up-regulation, at the bottom of the list are the genes with the "strongest" down-regulation and the genes not changing are in the middle. The metric score I like to use is the sign of the fold change multiplied by the inverse of the p-value, although there may be better methods out there
Read more

Two subtle problems with over-representation analysis

Image
Over-representation analysis is a helpful and really frequently used technique for understanding trends from omics data and gene lists more generally. Just to demonstrate this, I tabulated the number of citations of some of the most popular web tools and packages, which reaches a massive 191k citations! But if you have used some of these tools, you will notice that they yield subtly different results. We were curiuous about that and ran a whole bunch of investigations into the internal workings of these tools, in particular clusterProfiler. We identified two subtle problems with clusterProfiler, which we unpack in detail in our new publication , but here I will give you a quick overview. Problem #1: The background problem The first one we call the “background problem,” because it involves the software eliminating large numbers of genes from the background list if they are not annotated as belonging to any category. This results in removing a large number of unannotated genes from the b
Read more

Uploading data to GEO - which method is faster?

If you have had to upload omics data to GEO before, you'll know it's a bit of a hassle and takes a long time. There are a few methods suggested by the GEO team if you are using the Unix command line: Using 'ncftp' ncftp set passive on set so-bufsize 33554432 open  ftp://geoftp:yourpasscode@ftp-private.ncbi.nlm.nih.gov cd uploads/your @mail.com_ yourfolder put -R Folder_with_submission_files Using 'lftp' lftp  ftp://geoftp:yourpasscode@ftp-private.ncbi.nlm.nih.gov cd uploads/ your @mail.com _ yourfolder mirror -R Folder_with_submission_files Using 'sftp' (expect slower transfer speeds since this method encrypts on-the-fly) sftp  geoftp @s ftp-private.ncbi.nlm.nih.gov password: yourpasscode cd uploads/ your @mail.com _ yourfolder mkdir new_geo_submission cd new_geo_submission put file_name Using 'ncftpput' (transfers from the command-line without entering an interactive shell) Usage example: ncftpput -F -R -z -u  geoftp  -p "yourpasscode"
Read more