Posts

Showing posts with the label Subread

DNA aligner accuracy: BWA, Bowtie, Soap and SubRead tested with simulated reads

Image
In the past few posts, we've looked at RNA-seq aligner performance in terms of accuracy and speed. In this post, I'll take a look at the accuracy of DNA aligners using simulated reads.

The first step is to download the genome of interest. I'm using Arabidopsis as its pretty small and good for quick benchmarking. I downloaded the genome from Ensembl plant ftp site (link).

Next step was to generate simulated reads that uniformly cover the genome at user-selected length and intervals. I couldn't find any previously made simulators to do exactly that, so I chained together some awk and bedtools commands (code at the bottom of the post) to generate the reads. I generated pseudo reads of 50, 100 & 200 bp in length at 10 bp intervals and output them in fasta format. Here is an example.

>1-0-50
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAA
>1-10-60
TAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT
>1-20-70
ACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAATCC

T…

RNA-seq aligner accuracy tested with simulated reads

Image
In the previous post we looked at how choice of RNA-seq aligner influenced results. In this post, we'll use simulated reads to empirically determine the accuracy of OLego, STAR, SubJunc and SubRead.

I made a pretty basic bash script (see below) to generate fasta format reads at uniform intervals along the length of transcripts without errors. The user can readily change the read length and the interval between read initiation. The script created 11.3 million 100 bp reads in 9 minutes so it is OK in terms of speed. It is designed to take Ensembl cDNA files as an input and has been tested on human and Arabidopsis. Here is what the generated reads look like

>AT2G01210.1:gene:AT2G01210_197863
CGTCAGCTTTCGTTCTGGGGAAGAGCGGAATCGGAATTGTCTACAAAGTG
>AT2G01210.1:gene:AT2G01210_197864
GTTCTAGAGAACGGGCTCACACTGGCCGTACGGAGATTGGGTGAAGGAGG
>AT2G01210.1:gene:AT2G01210_197865
GTCTCAGAGATTCAAGGAGTTTCAGACAGAAGTTGAAGCCATAGGGAAAC
>AT2G01210.1:gene:AT2G01210_197866
TAAAACATCCTAACATTGCTAGTCTTC…

RNA-seq aligners: Subread, STAR, HPG aligner and Olego | PART 2

Image
In the previous post, I compared the speed of several RNA aligners. In this post, we'll take a closer look at the results generated by these different aligners; Subread/Subjunc, STAR, HPG aligner and Olego. In addition, we will use BWA MEM as an example of what happens when you use a DNA aligner to analyse RNA-seq. For the test, we've been using 101 bp Arabidopsis mRNA-seq data from GEO accession GSE42968. For simplicity, I use only the forward read in the paired-end dataset. I used fastx-toolkit to remove low quality bases from the 3' end (base qual threshold of 20).

One of the simplest ways to assess the quality of an alignment is to determine the proportion of reads that are mapped to the genome and the proportion that map to exons. After the aligners did their work, I used featureCounts to quantify the number of aligned reads with a mapping quality >10. Here is the data for the first sample in the series, SRR634969 which contained 14.5 million reads.

The first thing…

RNA-seq aligners: Subread, STAR, HPG aligner and Olego

Image
In this post I compare the speed of Subread/Subjunc, STAR, HPG aligner and Olego. I will use real RNA-seq data from GEO accession GSE42968 and align to the Arabidopsis thaliana genome. All code used is found at the bottom of this post. The benchmarking was performed on a standard 8 core workstation with 8 GB RAM.

Index the Arabidopsis thaliana genome The first step in any RNA-seq analysis is to prepare the genome for alignment. Subread was the quickest.
Align RNA-seq reads I down sampled the sequence (SRA accesion:SRR634969) file to generate files containing 1M, 2M, 5M, 10M and 14M reads selected randomly. Fastq quality trimmer was used to trim low quality bases from the 3' end and filter low quality reads. Then I used Olego, Subread, Subjunc, STAR and HPG aligner to align the reads. (I wanted to test HPG aligner in both the BWT and SA modes but didn't have the 17 GB RAM to test SA algorithm sadly.) In all the below cases the sequence files were uncompressed fastq (101 bp read…