Genome Spot

I previously posted about different ways to obtain Venn diagrams, but what if you have more than 4 lists to intersect? These plots become messy and not easy to read. One alternative which has become popular is the upset plot. There is an excellent summary of the philosophy behind this approach in this article and academic paper here. An example plot is below:



In this post, I'll describe how to get from lists of genes in text files and present it as an UpSet plot using R. As with most R packages, you'll find that loading in the data is the hardest part, and that data import is the least documented aspect.

First I'll generate some random gene lists using a quick and dirty shell script. My complete list contains 58302 genes and looks like this:
$ head -5 Homo_sapiens.GRCh38.90.gnames.txt ENSG00000000003_TSPAN6 ENSG00000000005_TNMD ENSG00000000419_DPM1 ENSG00000000457_SCYL3 ENSG00000000460_C1orf112
This is the script which generates random subsets of genes with the suffix &quo…

Previously I wrote about how to make a gene expression rankfile using the unix shell. While this works for me just fine, there are some differences in the behaviour of shell tools like awk an sed that make it unusable for mac users.

Therefore, I think the best solution is to show you how to do this in R, which you can install on Linux, Mac and Windows systems.

The expression data for this demo looks like this (the first 5 columns).


Name                        logFC               logCPM            LR                PValue ENSG00000134294.9_SLC38A2   0.365464972841137   8.35504063447063  80.9697378748286  2.29200821312451e-19 ENSG00000164692.13_COL1A2   0.369440969815233   6.9371167845581   59.239238358843   1.39621819298599e-14 ENSG00000117152.9_RGS4      0.417512339007825   6.27805181231213  48.690887963755   2.99655418444362e-12 ENSG00000120738.7_EGR1      -0.448872068345368  5.72373823077344  40.5159113813129  1.95021420597484e-10 ENSG00000236552.1_RPL13AP5  -0.263118776572713  7.87437056…

One of the most common tasks in gene expression analysis is to compare different profiling experiments. There are three main strategies:
Compare all data points - using a correlation analysisCompare sets of up and down-regulated genes - using a binomial or Fisher exact testCompare sets of genes within a profile - such as GSEA test In this post, I'll describe how correlation analysis is used between expression data sets of all detected genes.

Merging data sets No matter what type of correlation used, the profiling data sets need to be merged. This means selecting a field that can the datasets can be merged on. This could be a array probe ID, gene accession number or gene symbol as in this case. I will compare gene expression profiles from two experiments (azacitidine in human and mouse cells). The human gene profile was generated by RNA-seq and the mouse data set by microarray.

The human data is currently in CSV format from Degust  and looks like this:

gene,c,aza,FDR,C1,C2,C3,A1,A2,A…

There is a need to make bioinformatics tools more user friendly and accessible to a wider audience. We have seen that Galaxy, GEO2R, Genevestigator and GenePattern have each developed a huge following in the molecular biology community, and this trend will continue with introduction of new RNA-seq analysis tools. Previously, I posted about differential gene expression analysis of RNA-seq performed by the DEB online tool. In this post, I introduce Degust, an online app to analyse gene expression count data and determine which genes are differentially expressed. Degust was written by David R. Powell (@d_r_powell) and was Supported by Victorian Bioinformatics Consortium, Monash University and VLSCI's Life Sciences Computation Centre.

In this test, I'll be using the azacitidine mRNA-seq data set that I have previously analysed. To make the count matrix, I used featureCounts.

First step in the process is to your RNA-seq count data. It can be done in tab or comma separated formats. …

In the previous post we looked at how choice of RNA-seq aligner influenced results. In this post, we'll use simulated reads to empirically determine the accuracy of OLego, STAR, SubJunc and SubRead.

I made a pretty basic bash script (see below) to generate fasta format reads at uniform intervals along the length of transcripts without errors. The user can readily change the read length and the interval between read initiation. The script created 11.3 million 100 bp reads in 9 minutes so it is OK in terms of speed. It is designed to take Ensembl cDNA files as an input and has been tested on human and Arabidopsis. Here is what the generated reads look like

>AT2G01210.1:gene:AT2G01210_197863
CGTCAGCTTTCGTTCTGGGGAAGAGCGGAATCGGAATTGTCTACAAAGTG
>AT2G01210.1:gene:AT2G01210_197864
GTTCTAGAGAACGGGCTCACACTGGCCGTACGGAGATTGGGTGAAGGAGG
>AT2G01210.1:gene:AT2G01210_197865
GTCTCAGAGATTCAAGGAGTTTCAGACAGAAGTTGAAGCCATAGGGAAAC
>AT2G01210.1:gene:AT2G01210_197866
TAAAACATCCTAACATTGCTAGTCTTC…

We will continue our series in the analysis of our azacitidine treated AML3 cell RNA-seq gene expression data set by generating a multidimensional scaling plot. This is a potentially useful way of showing variability in datasets, especially when the number of samples is large. Trawling the blogs, I found a really quick and easy way to do this in R (thanks Michael Dondrup@BioStars) that can be used to analyse the count matrix.

x<-scale(read.table("CountMatrix.xls", row.names=1, header=TRUE))
pdf("MDSplot.pdf") 
plot(cmdscale(dist(t(x))), xlab="Coordinate 1", ylab="Coordinate 2", type = "n") ; text(cmdscale(dist(t(x))), labels=colnames(x), ) 
dev.off() The closer the labels are together, the more similar the samples are. So it is good to see that the untreated samples are clearly separated from the azacitidine treated samples. UNTR1 is a bit far away from the other two replicates as suggested by the heatmap in the previous post.

In the last post of this series, I left you with a gene expression profile of the effect of azacitidine on AML3 cells. I decided to use the DESeq output for downstream analysis. If we want to draw a heatmap at this stage, we might struggle because the output provided by the DEB applet does not send back the normalised count data for each sample.

It is not really useful to plot all 5704 genes with FDR adjusted p-values <0.05 on the heatmap, so I will simply show the top 100 by p-value. Here are the general steps I will use in my R script below:

Read the count matrix and DESeq table into R and merge into one tableSort based on p-value with most significant genes on topSelect the columns containing gene name and raw countsScale the data per rowSelect the top 100 genes by significanceGenerate the heatmap with mostly default values Google searches show that R has some quite elaborate heatmap options, especially with features from ggplot2 and RColorBrewer. In this example, I will use buil…